BBa_K197004 1 BBa_K197004 {VtaA11 AtD} 2009-10-20T11:00:00Z 2015-05-08T01:11:18Z <pre> Pool O09ig113 through O09ig120, assemble by PCA PCR O09ig113/O09ig120 on PCA reaction (269, EcoRI/BamHI Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-B09ig113 {?VtaA11 AtD?} ---- O09ig113 PCA assembly of {?VtaA11 AtD?} (B09ig113) CCATAGAATTCATGAGATCTAACAACAAAGCTCTGCGTGCTGGTATCG O09ig114 PCA assembly of {?VtaA11 AtD?} (B09ig113) CCTGCGGCAGACCAGCAGCAGCGTTAGAACCAGCGATACCAGCACGCAGAGCT O09ig115 PCA assembly of {?VtaA11 AtD?} (B09ig113) TGCTGCTGGTCTGCCGCAGGTTTATATTCCGGGTAAATCTATGGTTGCTGTTT O09ig116 PCA assembly of {?VtaA11 AtD?} (B09ig113) CCAGAGCAGACTGACCTTTGAAAGTGCCAGCAGAAACAGCAACCATAGATTTA O09ig117 PCA assembly of {?VtaA11 AtD?} (B09ig113) CAAAGGTCAGTCTGCTCTGGCTGTTGGTTACTCTCGTGCTTCTGACAACGGTA O09ig118 PCA assembly of {?VtaA11 AtD?} (B09ig113) TGTTAGCGTTACCTTGGAGTTTCAGGATCAGTTTACCGTTGTCAGAAGCACGA O09ig119 PCA assembly of {?VtaA11 AtD?} (B09ig113) ACTCCAAGGTAACGCTAACACCTCTGGTGAAATGGGTGGTTCTGTTGGTGTTG O09ig120 PCA assembly of {?VtaA11 AtD?} (B09ig113) CGTTAGGATCCCCACTGGTAACCAACACCAACAGAACCACCC </pre> This is an Autotransporter of the AT-2 family from the organism Haemophilus parasuis. Autotransporters are proteins that form a pore in the outermembrane and and pull their N terminus through this pore in order to expose it to the extracellular space. N-terminal fusions of proteins to this part may permit the cell surface display of the fused protein. false false _294_ 0 4867 271 It's complicated false N/A false Patrick Harrigan BBa_K197004_sequence 1 gatctaacaacaaagctctgcgtgctggtatcgctggttctaacgctgctgctggtctgccgcaggtttatattccgggtaaatctatggttgctgtttctgctggcactttcaaaggtcagtctgctctggctgttggttactctcgtgcttctgacaacggtaaactgatcctgaaactccaaggtaacgctaacacctctggtgaaatgggtggttctgttggtgttggttaccagtggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z