BBa_K197008 1 BBa_K197008 {upaG_short} 2009-10-20T11:00:00Z 2015-05-08T01:11:18Z <pre> PCR ca998/O09ig277 on M10026 (279, EcoRI/BamHI) Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-B09upaG {<espP(beta)>} ---- ca998 Forward Oligo CCATAGAATTCATGAGATCTTGGACCCAGATGTCTTCTGGCACTC O09ig277 Reverse Oligo for the removal of stop codon from {<upaG_short>} CGTTAGGATCCccactgaataccggcaccgagtgcg </pre> An Autotransporter from Escherichia Coli. Autotransporters are proteins that form a pore in the outermembrane and and pull their N terminus through this pore in order to expose it to the extracellular space. N-terminal fusions of proteins to this part may permit the cell surface display of the fused protein. false false _294_ 0 4867 271 It's complicated false N/A false Patrick Harrigan BBa_K197008_sequence 1 gatctgttgagatggataacaaactgtccaaaactgaaagcaagctgagtggtggtatcgcttctgcaatggcaatgaccggtctgccgcaggcttacacgccgggtgccagcatggcctctattggtggcggtacttacaacggtgaatcggctgttgctttaggtgtgtcgatggtgagcgccaatggtcgttgggtctacaaattacaaggtagtaccaatagccagggtgaatactccgccgcactcggtgccggtattcagtggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z