BBa_K197015 1 BBa_K197015 {eCPX (circularly permuted OmpX)} 2009-10-20T11:00:00Z 2015-05-08T01:11:18Z <pre> PCR ca998/O09ig282 on M10014 (477, EcoRI/BamHI) Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-O09ig282 {<eCPX>} ------------------------------------- Ca998 forward oligo gtatcacgaggcagaatttcag O09ig282 reverse oligo with stop codons removed for {<eCPX>} ccggtGGATCCAGAGCTTGCAGTACGGCTTT </pre> Features: protein is an enhanced CPX variant located in the outermembrane that joins the N- and C-termini of OmpX. Autotransporters are proteins that form a pore in the outermembrane and and pull their N terminus through this pore in order to expose it to the extracellular space. N-terminal fusions of proteins to this part may permit the cell surface display of the fused protein. false false _294_ 0 5247 9 It's complicated false N/A false Gabriela Guzman Lopez Aguado BBa_K197015_sequence 1 gatctggtcagtctggtgactacaacaaaaaccagtactacggcatcactgctggtccggcttaccgcattaacgactgggcaagcatctacggtgtagtgggtgtgggttatggtaaattccagaccactgaatacccgacctacaaacacgacaccagcgactacggtttctcctacggtgcgggtctgcagttcaacccgatggaaaacgttgctctggacttctcttacgagcagagccgtattcgtagcgttgacgtaggcacctggattgcctctgttggttaccgcttcggatctaaacagtctaaagcgacttctactgtaactggcggttacgcacagagcgacgctcagggccaaatgaacaaaatgggcggtttcaacctgaaataccgctatgaagaagacaacagcccgctgggtgtgatcggttctttcacttacaccgagaaaagccgtactgcaagctctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z