BBa_K197018 1 BBa_K197018 mgfp-5 2009-10-20T11:00:00Z 2015-05-08T01:11:18Z gene synthesized, gene taken from this paper: Dong Soo Hwang et al. Expression of Functional Recombinant Mussel Adhesive Protein Mgfp-5 in Eschericia coli. American Society for Microbiology. June 2004; 70(6): 3352-3359. Available online at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC427802/ A mussel foot protein that plays a role in the adhesion of the organism to rocks and other substrates. This can be surface displayed on bacterial cells to make an adherent bacteria or a glue like substance. false false _294_ 0 5247 9 It's complicated true n/a false Gabriela Guzman Lopez Aguado BBa_K197018_sequence 1 tcttccgaggaatacaaaggtggttactacccgggtaacacctaccactaccactctggtggttcttaccacggttctggttaccacggtggttacaaaggtaaatactacggtaaagctaaaaaatactactacaaatacaaaaactctggtaaatacaaatacctgaaaaaagctcgtaaataccaccgtaaaggttacaaaaaatactacggtggtggttcttct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z