BBa_K197020 1 BBa_K197020 strep 2009-10-20T11:00:00Z 2015-05-08T01:11:18Z PCR ca998/ca1363R on pBca9145-Bca9494 (1539 bp, EcoRI/BamHI) Sub into pBca9495CA-Bca1144#5 (EcoRI/BamHI, 3039+910, L) Product is pBca9495CA-Bca1363 {Pbad.rbs.pp.ST} ---- ca998 Forward Sequencing of pSB1A2/pSB1A3 gtatcacgaggcagaatttcag ca1363R Reverse StrepTag ccataGGATCCctgcccagactgCCCTCCCTC The streptavidin peptide binds to a biotin like protein and this can be used for tagging and purification. false false _294_ 0 5247 9 It's complicated false N/A false Gabriela Guzman Lopez Aguado BBa_K197020_sequence 1 gatctggcggccagagcggctctgcagaatgccatccgcagggcccgccgtgcattgaaggccgcaaataaggatctccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z