BBa_K197022 1 BBa_K197022 KILR 2009-10-20T11:00:00Z 2015-05-08T01:11:18Z Construction of {<KILR>} basic part Wobble Oph024-F/Oph025-R (136 bp, EcoRI/BamHI) Sub into pBca9495AK-Bca1144#5 (EcoRI/BamHI, L) Product is pBca9495AK-M10037 {<KILR>} ---- Oph024-F foward oligo for cloning of {<KILR>} ccataGAATTCatgAGATCTgttaaagaactggaagacaaaaacgaagaactgctgtctaaaatctaccacctgcg Oph025-R reverse oligo for cloning of {<KILR>} ctgatGGATCCgcaaccaccacgttcaccaaccagttttttcagacgagcaacttcgttacgcaggtggtagattttagacagc A heterodimeric peptide that dimerizes to EILD. This can be used for adhering two cells together to evolve new two cell chemistry and functions. false true _294_ 0 5247 9 It's complicated true N/A false Gabriela Guzman Lopez Aguado BBa_K197022_sequence 1 gatctgttaaagaactggaagacaaaaacgaagaactgctgtctaaaatctaccacctgcgtaacgaagttgctcgtctgaaaaaactggttggtgaacgtggtggttgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z