BBa_K1973001 1 BBa_K1973001 nasF 2016-10-08T11:00:00Z 2016-10-09T11:39:45Z It was obtained by PCR from a plasmid containing its sequence. nasF is an attenuator of transcription elongation (terminator) from Klebsiella pneumoniae that decreases the basal expression from the Psal promoter. The nasR protein disrupts the terminator structure and allows the expression again, providing an useful tool for tight ON/OFF expression systems. false false _2440_ 30003 30003 9 false No special considerations. false Laura Claret Fern??ndez annotation2489358 1 nasF transcription terminator range2489358 1 1 104 BBa_K1973001_sequence 1 gagtgaataaaaggttttgggcagcgcgccaatggcggcgcgtatgtccagggataaaggcgtccagcggtgcgtaagcaccgccgggcgctttttttttgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z