BBa_K1973013 1 BBa_K1973013 Pm (1) 2016-10-08T11:00:00Z 2016-10-09T11:51:21Z It was obtained by PCR from a plamid that had its sequence. Pm1 BBa_K1973013 Pm1 is one variant of the promoter for the xylS/Pm expression system. It was obtained by site-directed mutagenesis PCR from the Pseudomonas putida plasmid pMPO52 in order to remove illegal restriction sites. The expression of this promoter is activated by XylS or XylS2 in the presence of benzoate and salicylate, respectively. false false _2440_ 30003 30003 9 false It did have to be site-directed mutagenized in position 65 in order to remove a PstI restriction site. false Laura Claret Fern??ndez annotation2489363 1 A -> T mutation range2489363 1 65 65 annotation2489362 1 Pm (1) range2489362 1 1 388 BBa_K1973013_sequence 1 tgatagagataagtccagccttgcaagaagcggatacaggagtgcaaaaaatggctatctctagtaaggcctaccccttaggctttatgcaacagaaacaataataatggagtcatgaccatgacaatgcacctggggctcgactatatagatagtctcgttgaagaagatgagaacgagggcatctaccgctgcaagcgcgagatgttcaccgaccctcggctgttcgatttagagatgaaacacatctttgagggcaactggatttatctcgcccacgagagccagattcccgagaagaacgactattacaccacgcagatgggccggcagccgatattcatcacacgcaacaaagatggtgagctgaatgccttcgtcaatgcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z