BBa_K1973015 1 BBa_K1973015 Pm (3) 2016-10-08T11:00:00Z 2016-10-09T11:58:27Z It was obtained from a plasmid containing its sequence. Pm3 is one variant of the promoter for the xylS/Pm expression system. It was obtained by site-directed mutagenesis PCR from the Pseudomonas putida plasmid pMPO52 in order to remove illegal restriction sites. The expression of this promoter is activated by XylS or XylS2 in the presence of benzoate and salicylate, respectively. false false _2440_ 30003 30003 9 false It had to be site-directed mutagenized at position 65 in order to remove a PstI restriction site. false Laura Claret Fern??ndez annotation2489367 1 A -> C mutation range2489367 1 65 65 annotation2489366 1 Pm (3) range2489366 1 1 388 BBa_K1973015_sequence 1 tgatagagataagtccagccttgcaagaagcggatacaggagtgcaaaaaatggctatctctagcaaggcctaccccttaggctttatgcaacagaaacaataataatggagtcatgaccatgacaatgcacctggggctcgactatatagatagtctcgttgaagaagatgagaacgagggcatctaccgctgcaagcgcgagatgttcaccgaccctcggctgttcgatttagagatgaaacacatctttgagggcaactggatttatctcgcccacgagagccagattcccgagaagaacgactattacaccacgcagatgggccggcagccgatattcatcacacgcaacaaagatggtgagctgaatgccttcgtcaatgcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z