BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1223006 1 BBa_K1223006 His-Tag 2013-09-06T11:00:00Z 2015-05-08T01:09:43Z synthetic c-term His tag for purification and identification of protein of interest. false false _1537_ 0 18143 9 It's complicated false purification and identification of protein of interest. false Orr Schlesinger annotation2335271 1 stop codon range2335271 1 25 27 annotation2335270 1 6X His-Tag range2335270 1 1 24 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_K1974022 1 BBa_K1974022 T7Promoter+RBS+Sf1a+linker+snowdrop-lectin+linker+6X His-Tag 2016-10-13T11:00:00Z 2017-03-28T10:01:21Z Artificial Synthesis It is under the control of the strong T7 promoter. Snowdrop-lectin acts as a carrier that could transport the toxin to insect???s nervous system, hemolymph and can improve the oral activity. A 6xHistag is added for further protein purification. false false _2441_ 30645 30645 9 true It is under the control of the strong T7 promoter. Snowdrop-lectin acts as a carrier that could transport the toxin to insect???s nervous system, hemolymph and can improve the oral activity. A 6xHistag is added for further protein purification. false YU-CHUN WU component2532927 1 BBa_K1223006 component2532922 1 BBa_I712074 component2532924 1 BBa_B0034 annotation2532922 1 BBa_I712074 range2532922 1 1 46 annotation2532924 1 BBa_B0034 range2532924 1 55 66 annotation2532927 1 BBa_K1223006 range2532927 1 75 101 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1223006_sequence 1 gtgcaccaccaccaccatcacgtgtaa BBa_K1974022_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggagaaatactagaggtgcaccaccaccaccatcacgtgtaa BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z