BBa_K1975005 1 BBa_K1975005 Cyan Fluorescent Protein 2016-10-04T11:00:00Z 2016-10-05T06:40:52Z The sequence for CFP genomic DNA from Acropora aculeus. This sequence has also been optimized for expression in B. subtilis. This is Cyan Fluorescent Protein that can be used to tag proteins of interest. It is a fluorescent protein that will show a blue color when it is excited at 405nm and it has the highest absorbance at 485nm. This sequence has been used to tag PhaA to visualize the expression of the protein. If the protein was expressed correctly, the cells would show a blue color when excited. The sequence is optimized for use in Bacillus subtilis. false false _2442_ 30862 30862 9 false To secure the optimal expression we choose to make a codon optimization of the genes. This was done through the Codon Optimization tool at IDT's webpage. false Joachim Steen Larsen BBa_K1975005_sequence 1 atgtctctttctaaacacgggataacccaggaaatgccgacaaagtatcacatgaaagggtctgtgaatggacacgaatttgagatcgaaggtgttggcaccggccacccatacgaaggcacccatatggccgaattggttattatcaagcccgctggcaagccattaccgttttcctttgacattctgtctacagtaattcaatatggaaatagatgcttcacaaagtatcctgccgatctgccggattactttaaacaggcgtaccctggaggtatgagctatgaacgctccttcgtctaccaggatggcggtatagcgacggctagttggaacgtcggtctggagggcaattgcttcatacacaagtctacttatctgggcgtcaacttcccagctgatggtcctgtaatgacgaaaaagaccatagggtgggacaaagcgtttgagaaaatgacagggtttaacgaggtgcttagaggggatgtaaccgaatttctcatgctggagggtggggggtatcatagctgccagtttcattcaacctacaaacctgagaaaccagtagagttacctccaaatcatgtgatagaacaccacatagtgcgcaccgatttaggcaagaccgcaaagggctttatggttaaacttgtccaacacgcagcagcacatgttaatccgttgaaagtgcaagcggccgcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z