BBa_K1975006 1 BBa_K1975006 Red Fluorescent Protein 2016-10-04T11:00:00Z 2016-10-05T07:23:04Z This sequence originally origin from the red sea anemone Discosoma. However, this sequence has been optimized to be used in Bacillus subtilis. This is Red Fluorescent Protein that can be used to tag proteins of interest. It is a fluorescent protein that will show a red color when it is excited at 558nm and it has the highest emission at 583nm. This sequence has been used to tag PhaB to visualize the expression of the protein. If the protein was expressed correctly, the cells would show a red color when excited. The sequence is optimized for use in Bacillus subtilis. false false _2442_ 30862 30862 9 false To secure the optimal expression we choose to make a codon optimization of the genes. This was done through the Codon Optimization tool at IDT's webpage. false Joachim Steen Larsen BBa_K1975006_sequence 1 atgcgtagctccaagaatgtgatcaaggagtttatgcgctttaaggtgcggatggagggcacagttaacggccacgagtttgaaatcgaaggtgagggagaggggcggccatatgagggccacaatactgttaaattaaaggtgacgaaagggggtcctttaccattcgcctgggatatactcagcccgcaatttcaatacggtagcaaagtgtacgtcaagcatccagcggacattccggattacaaaaaacttagttttccagagggcttcaagtgggagagagtgatgaatttcgaggatggcggcgtcgtgacagtcacccaagactcttctctgcaagacggctgctttatttataaggtgaagtttattggggtaaacttcccatctgacgggccggttatgcagaagaaaacaatggggtgggaggctagcaccgaaagactgtatccgagagatggggtcttaaagggcgagatccacaaagcgttaaaattgaaggacgggggacattacctcgtggagtttaagtctatatatatggctaagaaaccagtgcaacttccaggttactactatgtggactccaaattagatatcacctcacataacgaagattataccattgttgagcaatatgaacgtacagagggaagacaccatttatttcttcaccggtgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z