BBa_K1975008 1 BBa_K1975008 Beta-Lactamase 2016-10-12T11:00:00Z 2016-10-13T05:12:52Z This sequence is obtained from the vector pHT254 by PCR. pHT254 is a shuttle vector for the use in E. coli and Bacillus subtilis. This part contain a beta-lactamase. The function of this enzyme is to degrade beta-lactam and other beta-lactam antibiotics. The way the enzyme does this is by enzymatic cleavage of the beta-lactam ring. This cleavage will open the ring and the molecule will loose its antibacterial effect. Because of this activity, this enzyme is a very good reporter gene for Escherichia coli. When the E. coli cells contain this BioBrick the cells will survive to grow in media that contain beta-lactam. Cells without the BioBrick will die because beta-lactam will inhibit the cell wall biosynthesis making division of the cells impossible. false false _2442_ 30862 30862 9 false The sequence was obtained by PCR from the shuttle vector pHT254. false Joachim Steen Larsen BBa_K1975008_sequence 1 tcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z