BBa_K1976026 1 BBa_K1976026 Colicin E2 immunity protein (+amber codon) 2016-10-12T11:00:00Z 2016-10-19T02:54:06Z Escherichia coli Immunity protein for Colicin E2 (+amber codon) false false _2443_ 25991 30994 9 false Synthesis feasible by IDT, no amber stop codon for termination false Sonja Elbrich, Claudia Kreher, Patrick Kunzmann, Nina Kuschik-Maczollek, Bianca Reisinger, Sabine Schäfer, Inka Schröter, Viktoria Schuster annotation2497960 1 amber codon range2497960 1 28 30 annotation2497961 1 ImE2 range2497961 1 1 261 BBa_K1976026_sequence 1 atggaactgaaacatagtattagtgattagaccgaggctgaatttctggagtttgtaaaaaaaatatgtagagctgaaggtgctactgaagaggatgacaataaattagtgagagagtttgagcgattaactgagcacccagatggttcagatctgatttattatcctcgcgatgacagggaagatagtcctgaagggattgtcaaggaaattaaagaatggcgagctgctaacggtaagtcaggatttaaacagggctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z