BBa_K1976029 1 BBa_K1976029 Colicin E2 immunity protein with RBS 2016-10-12T11:00:00Z 2016-10-19T03:01:07Z Escherichia coli Immunity protein for Colicin E2 with RBS false false _2443_ 25991 30994 9 false Synthesis feasible by IDT, no amber stop codon for termination false Sonja Elbrich, Claudia Kreher, Patrick Kunzmann, Nina Kuschik-Maczollek, Bianca Reisinger, Sabine Sch&#228;fer, Inka Schr&#246;ter, Viktoria Schuster component2497980 1 BBa_K1976027 component2497978 1 BBa_B0034 annotation2497980 1 BBa_K1976027 range2497980 1 19 279 annotation2497978 1 BBa_B0034 range2497978 1 1 12 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1976027 1 BBa_K1976027 Colicin E2 immunity protein 2016-10-12T11:00:00Z 2016-10-13T08:42:42Z Escherichia coli Immunity protein for Colicin E2 false false _2443_ 30994 30994 9 false Synthesis feasible by IDT, no amber stop codon for termination false Patrick Kunzmann annotation2497963 1 ImE2 range2497963 1 1 261 BBa_K1976027_sequence 1 atggaactgaaacatagtattagtgattacaccgaggctgaatttctggagtttgtaaaaaaaatatgtagagctgaaggtgctactgaagaggatgacaataaattagtgagagagtttgagcgattaactgagcacccagatggttcagatctgatttattatcctcgcgatgacagggaagatagtcctgaagggattgtcaaggaaattaaagaatggcgagctgctaacggtaagtcaggatttaaacagggctga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1976029_sequence 1 aaagaggagaaatactagatggaactgaaacatagtattagtgattacaccgaggctgaatttctggagtttgtaaaaaaaatatgtagagctgaaggtgctactgaagaggatgacaataaattagtgagagagtttgagcgattaactgagcacccagatggttcagatctgatttattatcctcgcgatgacagggaagatagtcctgaagggattgtcaaggaaattaaagaatggcgagctgctaacggtaagtcaggatttaaacagggctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z