BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1976051 1 BBa_K1976051 Trypsin Fragment of Colicin E2 with B0034 as a RBS 2016-10-13T11:00:00Z 2016-10-19T05:22:43Z Assembly of BBa_K1976049 with B0034 Fragment of Colicin E2 as if treated with trypsin with B0034 as a ribosomal binding site. false false _2443_ 26392 26392 9 false It needs an RBS false Alana Gouveia, Franziska Hameister, Jonas Sindlinger, Maik Schork component2508829 1 BBa_K1976049 component2508828 1 BBa_B0034 annotation2508829 1 BBa_K1976049 range2508829 1 19 434 annotation2508828 1 BBa_B0034 range2508828 1 1 12 BBa_K1976049 1 BBa_K1976049 Trypsin Fragment of Colicin E2 2016-10-13T11:00:00Z 2016-10-19T05:22:06Z IDT Gblock The fragment of Colicin, which one would obtain from treating Colicin E2 with Trypsin false false _2443_ 26392 26392 9 false We chose this design based on a paper, which stated, that the trypsin treated fragment of Colicin E2 still exhibited DNase activity. false Alana Gouveia, Franziska Hameister, Jonas Sindlinger, Maik Schork BBa_K1976051_sequence 1 aaagaggagaaatactagatgaagcttgataaggagtcgaagcgcaacaaacccggcaaagctaccggtaaggggaagcctgtcggtgacaagtggttagatgatgcaggcaaggattcaggggccccaattccggatcgcattgctgacaaattacgcgataaggagttcaaaaacttcgatgattttcgtaaaaaattttgggaggaagtgagtaaagaccctgacttgtcaaagcaatttaaaggaagtaataagaccaacattcagaaaggaaaggctccgttcgcgcgtaagaaggatcaggtaggtgggcgtgagcgtttcgaacttcatcacgacaaaccgatcagtcaggacggtggggtctatgatatgaataatatccgtgttaccactccaaaacgtcatattgacatccaccgcggaaagaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1976049_sequence 1 atgaagcttgataaggagtcgaagcgcaacaaacccggcaaagctaccggtaaggggaagcctgtcggtgacaagtggttagatgatgcaggcaaggattcaggggccccaattccggatcgcattgctgacaaattacgcgataaggagttcaaaaacttcgatgattttcgtaaaaaattttgggaggaagtgagtaaagaccctgacttgtcaaagcaatttaaaggaagtaataagaccaacattcagaaaggaaaggctccgttcgcgcgtaagaaggatcaggtaggtgggcgtgagcgtttcgaacttcatcacgacaaaccgatcagtcaggacggtggggtctatgatatgaataatatccgtgttaccactccaaaacgtcatattgacatccaccgcggaaagaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z