BBa_J23107 1 BBa_J23107 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 It's complicated true N/A true John Anderson BBa_K1976027 1 BBa_K1976027 Colicin E2 immunity protein 2016-10-12T11:00:00Z 2016-10-13T08:42:42Z Escherichia coli Immunity protein for Colicin E2 false false _2443_ 30994 30994 9 false Synthesis feasible by IDT, no amber stop codon for termination false Patrick Kunzmann annotation2497963 1 ImE2 range2497963 1 1 261 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1976048 1 BBa_K1976048 DNase domain of Colicin E2 2016-10-13T11:00:00Z 2016-10-19T05:22:00Z IDT Gblock The DNase domain of Colicin E2, without both of its other domains. false false _2443_ 26392 26392 9 false We chose a rational design approach. false Alana Gouveia, Franziska Hameister, Jonas Sindlinger, Maik Schork annotation2528641 1 miniColicin E2 range2528641 1 1 399 BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1976052 1 BBa_K1976052 Colicin E2 DNase domain and immunity Protein with Anderson Promoters 2016-10-13T11:00:00Z 2016-10-19T05:21:52Z Assembly of the parts, each amplified with primers including the Anderson promoters Colicin E2 DNase domain and immunity Protein with Anderson promoters false false _2443_ 26392 26392 9 false As the DNase needs the immunity protein to inhibit it for use in e. coli, it needs a higher expression than the DNase. false Alana Gouveia, Franziska Hameister, Jonas Sindlinger, Maik Schork component2509100 1 BBa_K1976027 component2509094 1 BBa_B0034 component2509095 1 BBa_K1976048 component2509096 1 BBa_J23104 component2509092 1 BBa_J23107 component2509098 1 BBa_B0034 annotation2509092 1 BBa_J23107 range2509092 1 1 35 annotation2509094 1 BBa_B0034 range2509094 1 44 55 annotation2509096 1 BBa_J23104 range2509096 1 471 505 annotation2509095 1 BBa_K1976048 range2509095 1 62 462 annotation2509100 1 BBa_K1976027 range2509100 1 532 792 annotation2509098 1 BBa_B0034 range2509098 1 514 525 BBa_K1976027_sequence 1 atggaactgaaacatagtattagtgattacaccgaggctgaatttctggagtttgtaaaaaaaatatgtagagctgaaggtgctactgaagaggatgacaataaattagtgagagagtttgagcgattaactgagcacccagatggttcagatctgatttattatcctcgcgatgacagggaagatagtcctgaagggattgtcaaggaaattaaagaatggcgagctgctaacggtaagtcaggatttaaacagggctga BBa_J23107_sequence 1 tttacggctagctcagccctaggtattatgctagc BBa_K1976052_sequence 1 tttacggctagctcagccctaggtattatgctagctactagagaaagaggagaaatactagatgaagcgcaacaaacccggcaaagctaccggtaaggggaagcctgtcggtgacaagtggttagatgatgcaggcaaggattcaggggccccaattccggatcgcattgctgacaaattacgcgataaggagttcaaaaacttcgatgattttcgtaaaaaattttgggaggaagtgagtaaagaccctgacttgtcaaagcaatttaaaggaagtaataagaccaacattcagaaaggaaaggctccgttcgcgcgtaagaaggatcaggtaggtgggcgtgagcgtttcgaacttcatcacgacaaaccgatcagtcaggacggtggggtctatgatatgaataatatccgtgttaccactccaaaacgtcatattgacatccaccgcggaaagtaaaatactagagttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagatggaactgaaacatagtattagtgattacaccgaggctgaatttctggagtttgtaaaaaaaatatgtagagctgaaggtgctactgaagaggatgacaataaattagtgagagagtttgagcgattaactgagcacccagatggttcagatctgatttattatcctcgcgatgacagggaagatagtcctgaagggattgtcaaggaaattaaagaatggcgagctgctaacggtaagtcaggatttaaacagggctga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1976048_sequence 1 atgaagcgcaacaaacccggcaaagctaccggtaaggggaagcctgtcggtgacaagtggttagatgatgcaggcaaggattcaggggccccaattccggatcgcattgctgacaaattacgcgataaggagttcaaaaacttcgatgattttcgtaaaaaattttgggaggaagtgagtaaagaccctgacttgtcaaagcaatttaaaggaagtaataagaccaacattcagaaaggaaaggctccgttcgcgcgtaagaaggatcaggtaggtgggcgtgagcgtttcgaacttcatcacgacaaaccgatcagtcaggacggtggggtctatgatatgaataatatccgtgttaccactccaaaacgtcatattgacatccaccgcggaaagtaaaa BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z