BBa_K1979001 1 BBa_K1979001 CBD (cbh2) 2016-08-19T11:00:00Z 2016-08-24T10:46:39Z The sequence is retrieved from Genbank. The sequence codes for cellulose binding domain cbh2 in prokaryotic cells. false false _2446_ 29797 29797 9 false Restriction sites Xho I and Bamh I are added. false MA Xinyi annotation2481557 1 CBD cbh2 range2481557 1 1 147 BBa_K1979001_sequence 1 ggtcaggcttgctcttctgtttggggtcagtgcggtggtcagaactggtctggtccgacctgctgcgcttctggttctacctgcgtttactctaacgactactactctcagtgcctgccgggtgctgcttcttcttcttctggttct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z