BBa_K1980000 1 Csp1 TAT Copper Storage Protein 1 2016-10-10T11:00:00Z 2016-10-12T02:23:43Z The source organism for the main protein sequence is Methylosinus trichosporium OB3b. The TAT sequence originate from E. coli multi copper oxidase enzyme CueO. We ordered it as codon optimised DNA from IDT. Copper Storage protein 1 (Csp1) is a tetrameric copper storage protein found in the periplasm of Methylosinus trichosporium OB3b. We investigated whether this part could act as a copper chelator when expressed in E. coli. We modified the protein by adding a TAT signal peptide from the E. coli enzyme CueO in place of the native TAT sequence and a C terminal his tag in an attempt to direct the protein to the periplasm. false false _2447_ 29607 29607 9 false Codon optimised for E. coli. TAT sequence changed to an E. coli TAT sequence. false Sam Garforth annotation2491869 1 stop range2491869 1 469 474 annotation2491868 1 Hexa Histidine range2491868 1 450 468 annotation2491867 1 Csp1 range2491867 1 85 450 annotation2491866 1 TAT signal peptide range2491866 1 1 84 BBa_K1980000_sequence 1 atgcaacgtcgtgacttcctgaaatacagtgttgctcttggggttgcttccgcattacccctttggtcccgcgcagtgtttgctggtgaagacccgcacgcaggccataagatgtctcatggtgcgaagtacaaagcacttcttgactcttcctcccattgtgttgcggtaggcgaggactgtctgcgtcactgttttgaaatgcttgctatgaacgacgcgagtatgggggcgtgcaccaaagccacctacgatcttgtagccgcctgcggagcattagctaagctggcggggaccaactcagcctttacaccagccttcgccaaagtcgttgctgatgtatgtgccgcgtgcaaaaaggaatgtgacaagtttccatccattgccgaatgtaaggcttgcggagaggcgtgccaggcttgtgcagaagagtgtcacaaagtcgcggcccatcatcaccaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z