BBa_K1980004 1 BBa_K1980004 pCusC promoter 2016-10-10T11:00:00Z 2016-10-23T07:20:32Z From E. coli genome This is just the promoter region of our part pCusC mKate. This promoter is copper sensitive via the CusS/CusR two component system. false false _2447_ 29607 29607 9 false Much longer than a version in the registry previously. false Sam Garforth annotation2525363 1 -35 range2525363 1 60 65 annotation2528663 1 CusR binding range2528663 1 30 51 annotation2525362 1 -10 range2525362 1 81 87 annotation2525361 1 pCusC range2525361 1 1 98 BBa_K1980004_sequence 1 gcgggatcagatggcaatcgcttattggcaaaatgacaattttgtcatttttctgtcaccggaaaatcagagcctggcgagtaaagttggcggcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z