BBa_K1982003 1 BBa_K1982003 CIBN(the N-terminal fragment of CIB1) 2016-09-11T11:00:00Z 2016-09-12T05:35:21Z The light-inducible heterodimerizering proteins CRY2 and CIB1 are both from Arabidopsis thaliana. Encodes the N-terminal fragment of transcription factor CIB1 (cryptochrome-interacting basic-helix-loop-helix). CIB1 interacts with CRY2 (cryptochrome 2) in a blue light-specific manner in yeast and Arabidopsis cells, and it acts together with additional CIB1-related proteins to promote CRY2-dependent floral initiation. CIB1 positively regulates FT expression. Cryptochrome 2 (CRY2) is a blue light stimulated photoreceptor, when exposed to blue light, it would interact withthe N-terminal fragment of CIB1 (CIBN) . Optogenetic systems enable precise spatial and temporal control of cell behavior. A light-activated CRISPR/Cas9 effector (LACE) system that induces transcription of endogenous genes in the presence of blue light.This was accomplished by fusing the light-inducible heterodimerizing proteins CRY2 and CIB1 to a transactivation domain and the catalytically inactive tCas9, respectively. The versatile LACE system can be easily directed to new DNA sequences for the dynamic regulation of endogenous genes[1]. false false _2449_ 30176 30176 9 false no false Zexu Li annotation2482938 1 ATG range2482938 1 1 3 annotation2482939 1 TAA range2482939 1 607 612 BBa_K1982003_sequence 1 atgaatggagctataggaggtgaccttttgctcaattttcctgacatgtcggtcctagagcgccaaagggctcacctcaagtacctcaatcccacctttgattctcctctcgccggcttctttgccgattcttcaatgattaccggcggcgagatggacagctatctttcgactgccggtttgaatcttccgatgatgtacggtgagacgacggtggaaggtgattcaagactctcaatttcgccggaaacgacgcttgggactggaaatttcaagaaacggaagtttgatacagagactaaggattgtaatgagaagaagaagaagatgacgatgaacagagatgacctagtagaagaaggagaagaagagaagtcgaaaataacagagcaaaacaatgggagcacaaaaagcatcaagaagatgaaacacaaagccaagaaagaagagaacaatttctctaatgattcatctaaagtgacgaaggaattggagaaaacggattatattcatgttcgtgcacgacgaggccaagccactgatagtcacagcatagcagaacgaaagagaaaagatcagtacccatacgatgttccagattacgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z