BBa_K1985001 1 BBa_K1985001 mamT 2016-10-13T11:00:00Z 2016-10-19T01:43:32Z The part comes from Magnetospirillum gryphiswaldense, sourced from Rokas Juodeikis in Professor Martin Warren's lab at the University of Kent. Usage: The mamT gene produces a protein that can be used to transfer electrons to iron molecules. It can be used in combination with other mam genes to form an electron transport complex (reference) that should form magnetic magnetite crystals when the cell is exposed to iron in solution. It was to assemble a construct of MamO, P, T and X in pSB1A3 for in vivo expression. Biology: MamT is a proposed cytochrome protein (reference) due to the presence of a heme binding motif within its sequence. It forms a complex with other Mam proteins on the membrane of the native species, Magnetospirillum gryphiswaldense. Together they promote magnetite crystal maturation within an organelle called the magnetosome. false false _2452_ 29337 29337 9 false Codon Optimised false Jasmine Cornish annotation2522223 1 mamT range2522223 1 15 539 BBa_K1985001_sequence 1 aggaggaattacatatgggtacgccagggggcggccgtcgctggatgaccttgatctcgatcaccttgctgatggtggtcggactgggactctattgggatgagctgtccctctccgccggcatctcccccgccacatcgccccgtcgggcggaggggcttttgttggggcggctgcccttgcccatggagccttcgattctgtcgccgctggagcatctcattgagccgccgcttcagtacaagctgatgaccattcgtcatatcccgccggtaatgccggggacaggcatgccccatccctatgtgggggattgcatccaatgccatctgatggtcggtggccccgctgccggatcacagttcaagacgccctatggcgccgtactggaaaacctgtcgcgggtccgcaaactggggcctcccattcttcccacgacgcgccagccgcatccgcctgccgggcgctgcattaagtgccatgacattgtggtcaaggtgcctgtggaaaagaagtccggcattaaatggctgttgtaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z