BBa_K1985004 1 BBa_K1985004 mamT his-tagged, signal sequence cleaved 2016-10-13T11:00:00Z 2016-10-19T02:19:20Z The part comes from Magnetospirillum gryphiswaldense, sourced from Rokas Juodeikis in Professor Martin Warren's lab at the University of Kent. Usage: The mamT gene produces a protein that can be used to transfer electrons to iron molecules. It can be used in combination with other mam genes to form an electron transport complex (reference) that should form magnetic magnetite crystals when the protein is exposed to into in solution. This sequence produces a soluble protein because it has the membrane anchor cleaved and is targeted to the secretory pathway, which will leave the protein in the periplasm. It was expressed, purified and then exposed to iron.(??) Biology: MamT is a proposed cytochrome protein (reference) due to the presence of a heme binding motif within its sequence. It forms a complex with other Mam proteins on the membrane of the native species, Magnetospirillum gryphiswaldense. Together they promote magnetite crystal maturation within an organelle called the magnetosome. false false _2452_ 29337 29337 9 false Codon Optimised false Jasmine Cornish annotation2522405 1 SecS-sol-mamT range2522405 1 15 560 BBa_K1985004_sequence 1 aggaggaattacatatggctaagtcactgttcagggcgctggtcgccctgtcttttcttgcgccactgtggctcaacgccgcgccgcgcgtcatcacgctttctcccgccgagctctgggatgagctgtccctctccgccggcatctcccccgccacatcgccccgtcgggcggaggggcttttgttggggcggctgcccttgcccatggagccttcgattctgtcgccgctggagcatctcattgagccgccgcttcagtacaagctgatgaccattcgtcatatcccgccggtaatgccggggacaggcatgccccatccctatgtgggggattgcatccaatgccatctgatggtcggtggccccgctgccggatcacagttcaagacgccctatggcgccgtactggaaaacctgtcgcgggtccgcaaactggggcctcccattcttcccacgacgcgccagccgcatccgcctgccgggcgctgcattaagtgccatgacattgtggtcaaggtgcctgtggaaaagaagtccggcattaaatggctgttgtaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z