BBa_K1985010 1 BBa_K1985010 Sequence coding for amyloid Sup35 residues 1-61 2016-10-13T11:00:00Z 2016-10-25T11:27:16Z Coding genome synthesised by IDT. This part is an improved version of a previously designed BioBrick (Part:BBa_K1739002), which was designed by the Kent 2015 iGEM team. This part contains three segments, the CsgA signal sequence, Sup35NM and a prion forming domain. Our improved BioBrick aims to optimize the aggregation process of amyloid fibrils with the addition of a short and specific prion forming domain of 61 aminoacid residues. This was inserted into the pSB1C3 backbone. false false _2452_ 29437 29437 9 false Making sure the part was compatible with pSB1C3 vector. false Rita Adriani annotation2530120 1 CsgA-SS_Sup35-1-61 range2530120 1 1 338 BBa_K1985010_sequence 1 aggaggaattacatatgaaactgcttaaagtagcagcgatcgcggcaattgtgttcagtggaagcgcgctggctggtgttgtacctcagtatggtggaggcggcaaccacggcggcggaggcaataattcagggccgaatgccgcggcgatgtcggattcaaaccagggcaacaaccagcaaaattaccagcagtattcccaaaacggcaaccagcaacaaggtaacaatcgctatcaggggtaccaggcgtacaatgcccaagcacaaccggcaggcggctattatcagaactaccagggctacagcggttaccaacagggtggttatcagtaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z