BBa_K1987042 1 BBa_K1987042 off -> on (mid) promoter 2016-10-13T11:00:00Z 2016-10-14T11:45:27Z E coli MG1655 This promoter can be inserted upstream of any gene in order to provide timed gene expression. This promoter is inactive during the early growth phase of e. coli, but becomes more active later on, leading to an "on -> off" expression pattern. *Note that this promoter also includes an unidentified RBS somewhere in the sequence. This promoter+RBS combination is intended to be treated as a single regulatory unit which cannot be subdivided, which is why it has been submitted as a "basic part." false false _2454_ 25063 25063 9 false N/A false Caroline Blassick BBa_K1987042_sequence 1 tcgccttatgcccgatgatattcctttcatcgggctatttaaccgttagtgcctcctttctctcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z