BBa_K1988000 1 BBa_K1988000 ppx2 homologue: exopolyphosphatase from M. phosphovorus 2016-10-13T11:00:00Z 2016-10-14T08:24:33Z This part sequence was obtained from 'Deciphering the Genome of Polyphosphate Accumulating Actinobacterium Microlunatus Phosphovorus' by Kawakoshi, et. al. <h1>PPX2 Homolog</h1> <p><b>Name:</b>Exopolyphosphatase</p> <p><b>Locus tag: </b> MLP_44770</p> <p><b>Function: </b> </p> There are two types of exopolyphosphatase, PPX1 and PPX2, both of which mediate the hydrolysis of the terminal phosphate of a polyphosphate chain. [1] In <i>Microlunatus phosphovorus</i>:</b> While most Actinobacteria species have both PPX1 and PPX2, <i>M. phosphovorus</i> only has one PPX2 homolog. [1] Cofactors and Modifications: </b> There are currently no known cofactors and modifications of the PPX2 homolog in M. phosphovorus. 3-D Structure: C-score: 1.01 The three-dimensional structure was predicted using the I-TASSER software [3]. All images shown are the models with the highest confidence, which is quantitatively measured with a C-score that typically falls within the range [-5,2], in which 2 represents the highest level of confidence, and -5 represents the lowest level of confidence. Gene length: 945 base pairs [4] Protein size:33.0 kDa [4] pH Range The PPX2 homolog in M. phosphovorus has yet to be characterized, and so there is no data for the pH range in which it functions. Temperature Range The PPX2 homolog in M. phosphovorus has yet to be characterized, and so there is no data for the temperature range in which it functions. <h2>References</h2> [1] A. Kawakoshi, H. Nakazawa, J. Fukada, M. Sasagawa, Y. Katano, S. Nakamura, A. Hosoyama, H. Sasaki, N. Ichikawa, S. Hanada, Y. Kamagata, K. Nakamura, S. Yamazaki and N. Fujita, "Deciphering the Genome of Polyphosphate Accumulating Actinobacterium <i>Microlunatus phosphovorus</i>", <i>DNA Research</i>, vol. 19, no. 5, pp. 383-394, 2012.<br> [2] <br> [3] Yang, R. Yan, A. Roy, D. Xu, J. Poisson and Y. Zhang, "The I-TASSER Suite: protein structure and function prediction", <i>Nature Methods</i>, vol. 12, no. 1, pp. 7-8, 2014. <br> [4] "ppx - Exopolyphosphatase - <i>Microlunatus phosphovorus</i> (strain ATCC 700054 / DSM 10555 / JCM 9379 / NBRC 101784 / NCIMB 13414 / VKM Ac-1990 / NM-1) - ppgK gene & protein", <i>Uniprot</i>, 2016. [Online]. Available: http://www.uniprot.org/uniprot/F5XI06. [Accessed: 22- Jul- 2016]. false false _2455_ 26037 26037 9 false Gene was optimized for E. coli K-12 using IDT codon optimization false Bowman Clark BBa_K1988000_sequence 1 gtggccacggaaccagttcgcgttggagctatcgactgcggaacaaatagtatccgtttgttaatcgcagaggcacgcgttgatggcagcttaattgaccttgtacgcgagttggagatcgtacgccttggtcaaggagtggacgccactggggagttacacccagacgctcttgctcgcacctttgcggcagccgaacgttatggggaacagctgcgcgcttacggcgtgcgccccgagcgcacgcgcgttgttgctacatcggccacccgtgacgctcgtaatgtcgaggatttcgatgcgggcatggctgcacgtttaggagtacgcccagagattatcagcggaacagaggaagcacgcttatctttcacaggcgcgttgtcgggcgttcgtgtggcctccgatggtcctatcttggttatggacatcggaggagggagcactgaacttgtgctgggtgatcgtacgggtcgtatcgatcgtgccgtcagcttgaatatcgggtccgtgcgtctgactgaacgcttcgggctggtgggcccgctgaccacggaagcacgtcagagcgctgcggcctatgtggacggccttcttgaccaattagaatggccctcgggcttactggggcaaattggctcttggattggagtggccggcacagtaacgacaatgagcgcccttaaacaaggccttatttcgtatgaccgcagtaaagtgcatggtagtgttctgtcacttgcagagatcgcggggttgtctaatcgcctggcgacgcttacaacggaggagatccacgatcttggagtcccggcggggcgcgctgacgttatcactgctggctctcttatcgccgatcgcgttgccaaccgtgtgggccgcccgatgattgtgagtgaaagcgacattttagacggcattgtgcttggcttgctggcacgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z