BBa_K1988004 1 BBa_K1988004 Pit B: Inorganic P Transport from M. Phosphovorus 2016-10-13T11:00:00Z 2016-10-14T05:51:50Z Genetic sequence from 'Deciphering the Genome of Polyphosphate Accumulating Actinobacterium Microlunatus Phosphovorus' by Kawakoshi, et. al. <h1>Pit Homologs</h1> <h2>Overview</h2> <p><b>Name:</b> Inorganic phosphate transporter</p> <p><b>Function: </b> Inorganic phosphate transporters are symporters of divalent metal-chelated phosphate and protons, and thus they require a proton motive force for phosphorus uptake. The electron transport chain is proposed to be the primary source of the proton motive force required for phosphate uptake in the PAO <i>???Ca</i> Accumulibacter phosphatis , and the electron transport chain may also be a source of the proton motive force for phosphate uptake in <i>M. phosphovorus</i>. Once the cell uptakes the phosphate, the phosphate is polymerized by PPK proteins.[1] </p> <p><b>In <i>Microlunatus phosphovorus</i>:</b> Polyphosphate accumulating organisms (PAOs) typically belong to either the Actinobacteria or the Proteobacteria phylum.<i>M. phosphovorus</i>, which has three Pit homologs, is among the species of Actinobacteria with the highest number of Pit genes. While gene expression and activity level of the gene product also contribute to the extent of PAO activity, the theoretical importance of multiple pit genes to PAO activity is supported by the high number of pit genes in the Proteobacteria <i>Candidatus</i> Accumulibacter phosphatis. [1] <i>???Ca</i> Accumulibacter phosphatis is a PAO that is considered crucial to the Enhanced Biological Phosphorus Removal process. [2]</p> <p><b>Location: </b> Membrane [3,4,5]</p> <p><b>Cofactors and Modifications</b> There are currently no known cofactors or modifications of the Pit homologs in <i>M. phosphovorus</i>.</p> <p><b>Images: </b> The three-dimensional structure of all proteins were predicted using the I-TASSER software [3]. All images shown are the models with the highest confidence, which is quantitatively measured with a C-score that typically falls within the range [-5,2], in which 2 represents the highest level of confidence, and -5 represents the lowest level of confidence.</p> <h2>Pit homolog A</h2> <p><b>Locus tag: </b> MLP_00530</p> <p><b>Image</b></p> <p>C-score: -1.69</p> <p><b>Gene length: </b> 1,176 base pairs</p> <p><b>Protein size:</b> 40.2 kDa</p> <p><b>Amino acid sequence: </b>MDWLLISVIA VIALALLFDF TNGFHDAANS VATVVATKAL PARLAPWFSA FFNFSAFFVV GTAVANTVAK VVNHDVEGVA VVFAALVAAI AWNYFTWYVG MPSSSSHAII GGLVGAGLAA GGTGAVNWGV VSKAVLAIVV SPLVAFTIAA VAMLILARIH KQWNLSEDAK AYKGLQLVSA AAVSFGHGAN DAQKTMGIMA AVLAAGGYIG LQADGTFEID WWIPLLAYSA ISIGTVWGGW KIIETMGLRI TKLRASSGLA ANVGAVTAIF GATGLGIPIS TTHAAASSVA GAGVASGKGV NGRVIREMVT AWVVTIPATV IVGFVMFKLT RLPGISAYLV VGAIMAALLT WIVWAMSKAM GADDLAKELP SDAETRQPVA ATRADGHGTG E [4] </p> <p><b>In <i>Microlunatus phosphovorus</i>:</b> Based on phylogenetic analysis, Pit homolog A is most homologous to Pit genes in the phylum Proteobacteria. [1]</p> <p><b>pH Range</b>The pit homologs in <i>M. phosphovorus</i> have yet to be characterized, and so there is no data for the pH range in which the pit homologs function.</p> <p><b>Temperature Range </b> The pit homologs in <i>M. phosphovorus</i> have yet to be characterized, and so there is no data for the pH range in which the Pit homologs function.</p> <h2>Pit homolog B</h2> <p><b>Locus tag:</b> MLP_29830</p> <p><b>Image</b></p> <p>C-score: -1.80 </p> <p><b>Gene length: </b> 1,224 base pairs</p> <p><b>Protein size:</b> 41.8 kDa</p> <p><b>Amino acid sequence: </b> MTEALFILVV VIVTALAFDF TNGFHDTGNA MATSIATGAL KPKAAVALSA ILNLVGAFLS IEVALTVSNK VVSIQDSSGV PIEALMGTPI LTIVFAGLVG GILWNLTTWL LGLPSSSSHA LFGGLIGSAI ASLGLSGVKW DGVITSILIP AFFAPLVAGL VAGIGTWTVY RLVAKIPESR RDAGFRWGQI GSASLVSLAH GTNDAQKTMG VITLALIAYG SWTDTHAIPF WVKAACAFAI AAGTYIGGWR VIRTLGKGLV EIHSPQGMAA ETASAAIILS SSHLGMALST THVATGSILG SGVGKRGAEV RWGVAGRMVV AWVTTLPAAA IVGALCWYLA SVIGGAVGIG VVFAILVAAA AWMFSRSRRT AINPNNVNAE WEGGLAVTEQ QDVAQETAKV PAGAERN [5]</p> <p><b>In <i>Microlunatus phosphovorus</i>:</b> Based on phylogenetic analysis, Pit homolog B is most homologous to Pit genes in the phylum Actinobacteria. [1]</p> <p><b>pH Range</b>The pit homologs in <i>M. phosphovorus</i> have yet to be characterized, and so there is no data for the pH range in which the pit homologs function.</p> <p><b>Temperature Range </b> The pit homologs in <i>M. phosphovorus</i> have yet to be characterized, and so there is no data for the pH range in which the Pit homologs function.</p> <h2>Pit homolog C</h2> <p><b>Locus tag: </b> MLP_51060</p> <p><b>Image</b></p> <p>C-score: -2.18</p> <p><b>Gene length: </b> 1,245 base pairs</p> <p><b>Protein size:</b> 42.2 kDa</p> <p><b>Amino acid sequence: </b>MTVLFVVITV IVVALIFDFT NGFHDSANSM AGPIATGALK PKTAVLIAAV LDVVGACLST EVARTISGGF FDDTLITAPI VLAGLVGAII WNLVTWLLGL PSSSSHALFG GLIGAVIVGA GFASVHYSVV VSKVLLPALV APAVAGIAAA GATALAYRVT RRTPRKYSEK GFKRGQAFTG SLVALAHGTS DGQKTMGVIT LVLIVSGFQA SGTGPHWWVV LAAGLATGLG TYSGGWRIMR TMGKGIVDIE TPQGAAAGAA TTATILASAN LGFGLSTTHV ATGSILGSGL GRRGATVRWS VARRMVTAWV LTLPGAAIVG GLAALLAEHG VVGSIILVSL LAIACVVIWR LSRRNQISHH NVTDSADVAV LSSAAASDTP GEPQLNGSRR SDIAPPAKAE RPKQKKRKKQ RSAA [6]</p> <p><b>In <i>Microlunatus phosphovorus</i>:</b> Based on phylogenetic analysis, Pit homolog C is most homologous to Pit genes in the phylum Actinobacteria. [1]</p> <p><b>pH Range</b>The pit homologs in <i>M. phosphovorus</i> have yet to be characterized, and so there is no data for the pH range in which the pit homologs function.</p> <p><b>Temperature Range </b> The pit homologs in <i>M. phosphovorus</i> have yet to be characterized, and so there is no data for the pH range in which the Pit homologs function.</p> <h2>References</h2> <p>[1] A. Kawakoshi, H. Nakazawa, J. Fukada, M. Sasagawa, Y. Katano, S. Nakamura, A. Hosoyama, H. Sasaki, N. Ichikawa, S. Hanada, Y. Kamagata, K. Nakamura, S. Yamazaki and N. Fujita, "Deciphering the Genome of Polyphosphate Accumulating Actinobacterium <i>Microlunatus phosphovorus</i>", <i>DNA Research</i>, vol. 19, no. 5, pp. 383-394, 2012.<br> [2] Y. Mao, D. Graham, H. Tamaki and T. Zhang, "Dominant and novel clades of <i>Candidatus</i> Accumulibacter phosphatis in 18 globally distributed full-scale wastewater treatment plants",<i>Scientific Reports</i>, vol. 5, p. 11857, 2015.<br> [3] "pit - Phosphate transporter - <i>Microlunatus phosphovorus</i> (strain ATCC 700054 / DSM 10555 / JCM 9379 / NBRC 101784 / NCIMB 13414 / VKM Ac-1990 / NM-1) - pit gene & protein", <i>Uniprot</i>, 2016. [Online]. Available: http://www.uniprot.org/uniprot/F5XGG0. [Accessed: 19- Jul- 2016].<br> [4] "pit - Phosphate transporter - <i>Microlunatus phosphovorus</i> (strain ATCC 700054 / DSM 10555 / JCM 9379 / NBRC 101784 / NCIMB 13414 / VKM Ac-1990 / NM-1) - pit gene & protein", <i>Uniprot</i>, 2016. [Online]. Available: http://www.uniprot.org/uniprot/F5XKC5. [Accessed: 19- Jul- 2016]. <br> [5] "pit - Phosphate transporter - <i>Microlunatus phosphovorus</i> (strain ATCC 700054 / DSM 10555 / JCM 9379 / NBRC 101784 / NCIMB 13414 / VKM Ac-1990 / NM-1) - pit gene & protein", <i>Uniprot</i>, 2016. [Online]. Available: http://www.uniprot.org/uniprot/F5XHB2. [Accessed: 19- Jul- 2016].<br> [6] Yang, R. Yan, A. Roy, D. Xu, J. Poisson and Y. Zhang, "The I-TASSER Suite: protein structure and function prediction", <i>Nature Methods</i>, vol. 12, no. 1, pp. 7-8, 2014.</p> false false _2455_ 26037 26037 9 false Codon optimized for E. coli K-12 using IDT Codon Optimizer false Bowman Clark BBa_K1988004_sequence 1 atgacggaagccctgtttatcctggtggtcgtgattgtgactgcgctggccttcgacttcaccaatggctttcacgatactgggaacgctatggctacatcaatcgccacaggagcccttaaacctaaagcggcggtagctttatctgctattcttaatttagtcggagctttcttgagtatcgaagtagctttgactgtatcgaataaagtcgtgtccattcaggattcatccggtgtcccgattgaagcattaatgggcacgccaattttgaccattgtatttgctggattggttggaggcatcttgtggaacttaacaacgtggttactggggctgccctcaagtagctcgcatgctttatttggaggattgattggcagcgcgattgcttccttagggttgtctggtgtcaaatgggacggggtgattacaagtatcctgatccctgctttttttgcaccgttggtagcggggcttgttgctggtatcggtacgtggacggtttaccgcttggtagccaaaatcccggaatctcgccgcgatgccggatttcgttgggggcaaatcgggtcggcaagtttggtgagtctggcgcacggtactaatgacgcccagaagactatgggtgtcatcacgttggccttaattgcatacgggagttggactgatacacacgctattccattttgggtaaaagcggcttgtgccttcgccatcgctgcgggaacgtatattggggggtggcgcgtcatccgtacccttgggaagggtctggttgagattcattcacctcaaggaatggctgcggaaacagcgtctgctgcaatcattctttcctcgtctcatttaggtatggccctttcgacaacccacgtcgcgacgggaagcattctggggtcaggagtgggaaaacgtggagctgaagttcgctggggagtggcggggcgcatggtagtggcgtgggtaaccacgctgcctgcggccgccatcgtcggtgctttatgttggtatctggcaagtgtcatcgggggggctgttggtattggtgttgtttttgcgatccttgtcgctgcggcggcatggatgttctctcgctcccgtcgtacggcgatcaaccctaacaatgtaaacgccgagtgggagggcgggcttgcggttacggaacaacaggacgtggcgcaggagaccgctaaagtccccgctggagcagaacgcaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z