BBa_K1988010 1 BBa_K1988010 PPGK ATPi: Polyphosphate ATP Independent Glucokinase 2016-10-13T11:00:00Z 2016-10-14T06:11:31Z Genetic sequence from 'Deciphering the Genome of Polyphosphate Accumulating Actinobacterium Microlunatus Phosphovorus' by Kawakoshi, et. al. <h1>PPGK</h1> <h2>Overview</h2> <p><b>Name:</b>Polyphosphate Dependent Glucokinase</p> <p><b>Function: </b></p> <p>PPGK catalyzes the first step in glycolysis, and therefore the presence of this enzyme suggests the importance of polyphosphate to metabolism in <i>M. phosphovorus</i>. [1]. Still, polyphosphate is not the only source of phosphorus in glycolysis, as evidenced by an ATP-only phosphofructokinase, which catalyzes the phosphorylation of D-fructose 6-phosphate [2].</p> <p><b>In <i>Microlunatus phosphovorus</i>:</b> M. phosphovorus is the first organism reported to have two homologs of PPGK. Microlunatus phosphovorus</i> is unique because, whereas other Actinobacteria species have PPGKs that utilize both ATP and polyphosphate as a phosphorus donor, <i>M. phosphovorus</i> has a PPGK that has been found to only use polyphosphate as a phosphorus donor. The second PPGK homolog has yet to be characterized, so whether or not that PPGK utilizes both ATP and polyphosphate or just polyphosphate is unknown. [1] </p> <p><b>Location: </b>Cytoplasm</p> <p> While the exact location of PPGK in the cytoplasm of <i>Microlunatus phosphovorus</i> is unknown, PPGK is located in the volutin granules of the Actinobacteria <i>Corynebacterium glutamicum<i>[3].The PPGKs in <i>M. phosphovorus</i> could possibly be located in the volutin granules as well.</p> <p><b>Cofactors and Modifications: </b>There are currently no known cofactors or modifications of the PPGK homolog and ATP independent PPGK in <i>M. phosphovorus</i>. </p> <p><b>Images: </b> The three-dimensional structure of all proteins were predicted using the I-TASSER software [4]. All images shown are the models with the highest confidence, which is quantitatively measured with a C-score that typically falls within the range [-5,2], in which 2 represents the highest level of confidence, and -5 represents the lowest level of confidence. </p> <h2>PPGK ATP Independent (ATPI)</h2> <p><b>Locus tag: </b> MLP_05430</p> <p><b>Image</b> </p> <p>C-score: 0.91</p> <p><b>Gene length: </b> 801 base pairs</p> <p><b>Protein size:</b> 28.1 kDa </p> <p><b>Amino acid sequence: </b>MTDTPPVAAP GRSVLGIDIG GSGIKGAPVD LATGLFAAER LRIDTPAKST PANVAKVVAE IVDHFKAEVG DGPIGITIPA VVTHGQTRSA ANIDHSWIDA EAEQIFEDVL QRDIYLMNDA DAAGIAEVHY GAAKGHPGLV IVTTLGTGIG SAMIHRGVLI PNSELGHLEI DGLDAETNAA SSAKERNDWS YSEWAPKLQR YYERLEALFW PDLIVVGGGV SKKAHKFLPK LKLKSQIIPA QLLNTAGIVG AAWLAADRLV HPDPMG [5]</p> <p><b>In <i>Microlunatus phosphovorus</i>:</b> PPGK ATPI can only use polyphosphate, and not ATP, as a phosphate donor. [1] </p> <p><b>pH Range</b> Optimal pH: 5.5 </p> <p><b>Temperature Range </b> Optimal temperature: 30??C [2]</p> <h2>PPGK homolog</h2> <p><b>Locus tag:</b> MLP_26610</p> <p><b>Image</b></p> <p>C-score: 1.25</p> <p><b>Gene length: </b> 762 base pairs</p> <p><b>Protein size:</b 26.1 kDa p> <p><b>Amino acid sequence: </b>MNETANIALG IDIGGTGIKG ALVDLETGAL VSDRFRLDTP RPALPAAVAD TVVAVAAHFD FAGPVGVAFP GVVLDGVVHT AANLHPDWIG ASLAELVGSR LSGPSVFLND ADAAGLAEAR FGAAKGVSGV VLLVTLGTGI GTAMISDGQL VPNSEFGHLE LDGLDAETYA AASARKRNNH TWEEWAGHAE HYLKYLEGLV WPKLFVLGGG ITKNPELWLH YLKPRTPIVL ATNINNAGII GAAAAAAQTQ QAG [6]</p> <p><b>In <i>Microlunatus phosphovorus</i>:</b> This PPGK homolog has yet to be characterized, so it is unknown whether or not this PPGK homolog can utilize ATP as a phosphate donor. [1]</p> <p><b>pH Range</b> The PPGK homolog in <i>M. phosphovorus</i> has yet to be characterized, and so there is no data for the pH range in which it functions.</p> <p><b>Temperature Range </b> The PPGK homolog in <i>M. phosphovorus</i> has yet to be characterized, and so there is no data for the temperature range in which it functions. </p> <h2>References</h2> <p>[1] A. Kawakoshi, H. Nakazawa, J. Fukada, M. Sasagawa, Y. Katano, S. Nakamura, A. Hosoyama, H. Sasaki, N. Ichikawa, S. Hanada, Y. Kamagata, K. Nakamura, S. Yamazaki and N. Fujita, "Deciphering the Genome of Polyphosphate Accumulating Actinobacterium <i>Microlunatus phosphovorus</i>", <i>DNA Research</i>, vol. 19, no. 5, pp. 383-394, 2012.<br> [2] S. Tanaka, S. Lee, K. Hamaoka, J. Kato, N. Takiguchi, K. Nakamura, H. Ohtake and A. Kuroda, "Strictly Polyphosphate-Dependent Glucokinase in a Polyphosphate-Accumulating Bacterium, <i>Microlunatus phosphovorus</i>", <i>Journal of Bacteriology</i>, vol. 185, no. 18, pp. 5654-5656, 2003. <br> [3] S. Pallerla, S. Knebel, T. Polen, P. Klauth, J. Hollender, V. Wendisch and S. Schoberth, "Formation of volutin granules in <i>Corynebacterium glutamicum</i>", <i>FEMS Microbiology Letters</i>, vol. 243, no. 1, pp. 133-140, 2005. <br> [4] Yang, R. Yan, A. Roy, D. Xu, J. Poisson and Y. Zhang, "The I-TASSER Suite: protein structure and function prediction", <i>Nature Methods</i>, vol. 12, no. 1, pp. 7-8, 2014. <br> [5] "ppgK - Polyphosphate-dependent glucokinase - <i>Microlunatus phosphovorus</i> - ppgK gene & protein", <i>Uniprot</i>, 2016. [Online]. Available: http://www.uniprot.org/uniprot/Q76LT2. [Accessed: 22- Jul- 2016].<br> [6] "ppgK - Polyphosphate-dependent glucokinase - <i>Microlunatus phosphovorus</i> (strain ATCC 700054 / DSM 10555 / JCM 9379 / NBRC 101784 / NCIMB 13414 / VKM Ac-1990 / NM-1) - ppgK gene & protein", <i>Uniprot</i>, 2016. [Online]. Available: http://www.uniprot.org/uniprot/F5XI06. [Accessed: 22- Jul- 2016].</p> false false _2455_ 26037 26037 9 false Codon optimized for E. coli K-12 using IDT Codon Optimizer false Bowman Clark BBa_K1988010_sequence 1 atgaccgacactcctccggtggctgcccctgggcgtagcgtccttggaatcgacattgggggaagcggcatcaaaggggcgccggtcgatttagctacgggacttttcgcagcagaacgcctgcgtattgatacgccggcaaaatcaactccggccaatgtggcaaaggtggtggccgagatcgtggatcacttcaaggccgaagtcggcgacgggcctattggaattacaatccctgctgtggtaactcatggtcagacccgcagcgccgcaaatattgaccatagctggattgatgccgaggcggaacagatctttgaggacgtcttgcaacgcgacatttatctgatgaacgacgctgacgcggccggtattgccgaggtacactacggggctgccaaaggtcatcctggcttggtgattgttactactttgggcaccgggattggctcagccatgatccatcgcggggtgctgattcctaattctgagttggggcatttggaaattgacggtttagacgccgaaacgaatgctgcgtcgtccgcaaaggaacgtaacgactggtcttattcagaatgggcacctaaacttcaacgttattatgagcgtttggaagctctgttttggccggatctgatcgtggttggtgggggggtgtctaaaaaagcccataaatttctgcccaaattgaaacttaagtcccaaattatcccggctcaacttttgaacacagcgggcattgtgggcgcggcttggttggcggctgatcgcttggtccacccagatccgatgggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z