BBa_K199003 1 BBa_K199003 RFP with CUAGU Addition 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z The template of the gene comes from BioBrick part E1010. We designed a forward primer that included the first 20 nucleotides on the 5' end, and a reverse primer that included the last 20 nucleotides on the 3' end of the RFP gene. This RFP reporter gene has a 5-base pair CUAGU addition after the start codon and before the rest of the gene. This is used in conjunction with the CUAGU tRNA (BioBrick part K199001). This CUAGU tRNA suppresses the frameshift caused by this 5-base pair addition in the reporter. false false _295_ 0 5109 9 It's complicated false We positioned the ATG before the 5-base codon and continued with the rest of the RFP gene. This way, the RBS wouldn't read the reporter gene without reading over the 5-base codon first. In order to ligate our 5-base pair addition at the desired position in the reporter gene, we utilized the restriction enzyme NcoI which cut at a single site 419 bp into the gene. false Romina Clemente annotation2013324 1 25 bp addition range2013324 1 687 711 annotation2013697 1 Double Stop range2013697 1 681 686 annotation2006728 1 Nco1 Restriction Site range2006728 1 424 429 annotation2006727 1 5-base pair CUAGU Addition range2006727 1 4 8 BBa_K199003_sequence 1 atgctagtgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z