BBa_K199005 1 BBa_K199005 RFP with CCACU Addition 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z The template of the gene comes from BioBrick part E1010. We designed a forward primer that included the first 20 nucleotides on the 5' end, and a reverse primer that included the last 20 nucleotides on the 3' end of the RFP gene. This RFP reporter gene has a 5-base pair CCACU addition after the start codon and before the rest of the gene. This is used in conjunction with the CCACU tRNA (BioBrick part [http://partsregistry.org/Part:BBa_K199002 K199002]). This CCACU tRNA suppresses the frameshift caused by this 5-base pair addition in the reporter. false false _295_ 0 5120 9 It's complicated false We positioned the ATG before the 5-base codon and continued with the rest of the RFP gene. This way, the RBS wouldn't read the reporter gene without reading over the 5-base codon first. In order to ligate our 5-base pair addition at the desired position in the reporter gene, we utilized the restriction enzyme NcoI which cut at a single site 424 bp into the gene. false Shamita Punjabi annotation2006731 1 5 base pair addition range2006731 1 4 8 annotation2013325 1 25 bp addition range2013325 1 687 711 annotation2013714 1 Double Stop range2013714 1 681 686 annotation2006732 1 Nco1 restriction site range2006732 1 424 429 BBa_K199005_sequence 1 atgccactgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z