BBa_K199007 1 BBa_K199007 CCAUC Suppressor tRNA (9-bp Anticodon and Produces Serine) 2009-06-28T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCAUC, which would normally cause a frame shift mutation. false false _295_ 0 5112 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCAUC. false Olivia Ho-Shing annotation2006983 1 3' Context range2006983 1 104 143 annotation2006981 1 5' Context range2006981 1 1 11 annotation2006982 1 Anticodon Loop range2006982 1 44 52 BBa_K199007_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtgtgatggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z