BBa_K199009 1 BBa_K199009 RFP with CCAUC Addition 2009-06-28T11:00:00Z 2015-05-08T01:11:18Z The template of the gene comes from BioBrick Part E1010. We designed a forward primer that included ATG, the 5-bp addition CCATC and the first 20 nucleotides on the 5' end of RFP after ATG. This made the edited 5' sequence for our RFP. This RFP reporter gene has a 5-bp addition, CCAUC, after the start codon and before the rest of the gene. This is used in conjunction with the CCAUC tRNA (Parts K199007 and K199008). These CCAUC tRNAs suppress the frameshift caused by this 5-bp addition in the reporter. false false _295_ 0 5112 9 It's complicated false We positioned the start codon, ATG, before the 5-bp codon and continued with the rest of the RFP gene. This way, the RBS wouldn't translate the reporter gene without reading over the 5-base codon first. In order to ligate our edited 5' sequence to the unchanged downstream portion of the RFP gene, we utilized the restriction enzyme NcoI that cuts at a single site 419-bp into BBa_E1010. false Olivia Ho-Shing annotation2013327 1 25 bp addition range2013327 1 687 711 annotation2006990 1 NcoI Restriction Site range2006990 1 424 429 annotation2006991 1 5-bp CCAUC Addition range2006991 1 4 8 annotation2013715 1 Double Stop range2013715 1 681 686 BBa_K199009_sequence 1 atgccatcgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z