BBa_K199016 1 BBa_K199016 CUAGC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUGCUAGAA 3'so that the anticodon GCUAG could be used to decode a frameshift mutation of CUAGC in a mRNA. false false _295_ 0 5118 9 It's complicated false none false Clifton Davis annotation2007936 1 5 nt anitcodon range2007936 1 46 50 BBa_K199016_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z