BBa_K199017 1 BBa_K199017 pOmpC 2009-07-07T11:00:00Z 2015-05-08T01:11:18Z PCR was used to isolate the promoter and add BioBrick ends to it. pOmpC is the promoter upstream of the OmpC gene which is native to E. coli. pOmpC is induced by high osmolarity, such as LB media and high sucrose concentration. false false _295_ 0 5395 9 It's complicated false none false Kin Lau BBa_K199017_sequence 1 tttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z