BBa_K199018 1 BBa_K199018 pOmpC (with intrinsic RBS) 2009-07-07T11:00:00Z 2015-05-08T01:11:18Z PCR to isolate the promoter and add BioBrick ends. pOmpC is the promoter upstream of the OmpC gene which is native to E. coli bacteria. This part includes an 80bp fragment between the end of the pOmpC promoter and the start codon of OmpC. This 80bp fragment has been found to contain an intrinsic RBS. false false _295_ 0 5395 9 It's complicated false none false Kin Lau BBa_K199018_sequence 1 tttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacttgccgactgattaatgagggttaatcagtatgcagtggcataaaaaagcaaataaaggcatataacagagggttaataac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z