BBa_J31008 1 mRFPr RFP reverse 2007-02-15T12:00:00Z 2015-08-31T04:08:45Z RFP reverse was PCR amplified from mRFP (BBaE1010). The mRFP coding sequence in the reverse orientation. This part requires a reverse RBS and reverse promoter to be expressed false false _61_ 0 1144 61 It's complicated false RFP reverse was PCR amplified from mRFP (BBaE1010) using the following primers: 5'-atgcactagtatggcttcctccgaagacgt "Spe mRFP F" 5'-gcattctagattaagcaccggtggagtgac "Xba mRFP R" false Karmella Haynes annotation1911764 1 Spe mRFP F range1911764 1 659 678 annotation1911765 1 Xba mRFP R range1911765 1 1 20 annotation1911761 1 mRFP reverse range1911761 1 1 678 BBa_K199027 1 BBa_K199027 RFPrev-RBSrev-pLux 2009-07-07T11:00:00Z 2015-05-08T01:11:18Z Ligations from existing parts. This is inverted RBS-RFP ligated upstream of pLux in forward orientation. This is intended to measure the backward activity of the promoter. false false _295_ 0 5395 9 It's complicated false none false Kin Lau component2010381 1 BBa_R0062 component2010379 1 BBa_J44001 component2010377 1 BBa_J31008 annotation2010381 1 BBa_R0062 range2010381 1 710 764 annotation2010379 1 BBa_J44001 range2010379 1 687 701 annotation2010377 1 BBa_J31008 range2010377 1 1 678 BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2045 1 LuxR/HSL range2045 1 1 20 annotation2046 1 -35 range2046 1 20 25 annotation2047 1 -10 range2047 1 42 47 annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2048 1 start range2048 1 53 53 BBa_J44001 1 BBa_J44001 Reverse RBS (RBS_rev) -- corresponds to BBa_B0030 2006-08-01T11:00:00Z 2015-08-31T04:08:48Z Cloned from synthetic oligos Released HQ 2013 Reverse version of RBS BBa_B0030 false false _61_71_ 0 606 61 In stock true Repeats in oligos caused unusual products during cloning true Todd Eckdahl annotation1893199 1 Reverse RBS range1893199 1 1 15 BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_K199027_sequence 1 ttaagcaccggtggagtgacgaccttcagcacgttcgtactgttcaacgatggtgtagtcttcgttgtgggaggtgatgtccagtttgatgtcggttttgtaagcacccggcagctgaaccggttttttagccatgtaggtggttttaacttcagcgtcgtagtgaccaccgtctttcagtttcagacgcattttgatttcacctttcagagcaccgtcttccgggtacatacgttcggtggaagcttcccaacccatggtttttttctgcataaccggaccgtcggacgggaagttggtaccacgcagtttaactttgtagatgaactcaccgtcttgcagggaggagtcctgggtaacggtaacaacaccaccgtcttcgaagttcataacacgttcccatttgaaaccttccgggaaggacagtttcaggtagtccgggatgtcagccgggtgtttaacgtaagctttggaaccgtactggaactgcggggacaggatgtcccaagcgaacggcagcggaccacctttggtaactttcagtttagcggtctgggtaccttcgtacggacgaccttcaccttcaccttcgatttcgaactcgtgaccgttaacggaaccttccatacgaactttgaaacgcatgaactctttgataacgtcttcggaggaagccattactagagtttctcctctttaattactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_J44001_sequence 1 tttctcctctttaat BBa_J31008_sequence 1 ttaagcaccggtggagtgacgaccttcagcacgttcgtactgttcaacgatggtgtagtcttcgttgtgggaggtgatgtccagtttgatgtcggttttgtaagcacccggcagctgaaccggttttttagccatgtaggtggttttaacttcagcgtcgtagtgaccaccgtctttcagtttcagacgcattttgatttcacctttcagagcaccgtcttccgggtacatacgttcggtggaagcttcccaacccatggtttttttctgcataaccggaccgtcggacgggaagttggtaccacgcagtttaactttgtagatgaactcaccgtcttgcagggaggagtcctgggtaacggtaacaacaccaccgtcttcgaagttcataacacgttcccatttgaaaccttccgggaaggacagtttcaggtagtccgggatgtcagccgggtgtttaacgtaagctttggaaccgtactggaactgcggggacaggatgtcccaagcgaacggcagcggaccacctttggtaactttcagtttagcggtctgggtaccttcgtacggacgaccttcaccttcaccttcgatttcgaactcgtgaccgttaacggaaccttccatacgaactttgaaacgcatgaactctttgataacgtcttcggaggaagccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z