BBa_K199032 1 BBa_K199032 pBad-CCAUC Suppressor tRNA (10-bp Anticodon) 2009-07-12T11:00:00Z 2015-05-08T01:11:18Z The pBad promoter is from the BioBrick Parts registry. Suppressor tRNA was made by de novo synthesis from single-stranded oligos. Based on the paper by Anderson et al. 2002. Causes low expression of a suppressor tRNA that suppresses a 5-bp codon CCAUC, Part K199008. false false _295_ 0 5112 9 It's complicated false We used the pBad promoter to transcribe lower levels of tRNA in a high copy plasmid, pSB1A2. false Olivia Ho-Shing component2011225 1 BBa_I13453 component2011229 1 BBa_K199008 annotation2011225 1 BBa_I13453 range2011225 1 1 130 annotation2011229 1 BBa_K199008 range2011229 1 139 282 BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K199008 1 BBa_K199008 CCAUC Suppressor tRNA (10-bp Anticodon and Produces Serine) 2009-06-28T11:00:00Z 2015-05-08T01:11:18Z De novo synthesis from single-stranded oligos. Based on the paper by Anderson et al. 2002. [http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf] This gene encodes for a tRNA suppressor that suppresses a 5-bp codon CCAUC, which would normally cause a frame shift mutation. false false _295_ 0 5112 9 It's complicated false We used the 10-bp anticodon loop that is complementary to the 5-bp codon CCAUC. false Olivia Ho-Shing annotation2006986 1 3' Context range2006986 1 105 144 annotation2006985 1 Anticodon Loop range2006985 1 44 53 annotation2006984 1 5' Context range2006984 1 1 11 BBa_K199032_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggatccaattcggagagatgccggagcggctgaacggaccggttttgatggagaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K199008_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggttttgatggagaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z