BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K199038 1 BBa_K199038 pBad-CUAGU Suppressor tRNA 2009-07-13T11:00:00Z 2015-05-08T01:11:19Z The pBad promoter is from the BioBrick Parts registry. Suppressor tRNA was made by de novo synthesis from single-stranded oligos. Based on the paper by Anderson et al. 2002. Causes low expression of a suppressor tRNA that suppresses a 5-bp codon CGGUC, Part K199028. false false _295_ 0 5109 9 It's complicated false We used the pBad promoter to transcribe lower levels of tRNA in a high copy plasmid, pSB1A2. false Romina Clemente component2011288 1 BBa_K199001 component2011284 1 BBa_I13453 annotation2011288 1 BBa_K199001 range2011288 1 139 281 annotation2011284 1 BBa_I13453 range2011284 1 1 130 BBa_K199001 1 BBa_K199001 CUAGU tRNA Suppressor (Produces Serine) 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CUAGU, which would normally cause a frame shift mutation. false false _295_ 0 5109 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CUAGU. false Romina Clemente annotation2006704 1 5' Context range2006704 1 1 11 annotation2006705 1 Anticodon Loop range2006705 1 44 52 annotation2006706 1 3' Context range2006706 1 104 143 BBa_K199038_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggatccaattcggagagatgccggagcggctgaacggaccggtttactagacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K199001_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttactagacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z