BBa_K199047 1 BBa_K199047 CCAAU tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUAUUGGAC 3'so that the anticodon AUUGG could be used to decode a frameshift mutation of CCAAU in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011944 1 5nt anti codon range2011944 1 46 50 BBa_K199047_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctattggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z