BBa_K199048 1 BBa_K199048 CCACC tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' UUGGUGGAA 3'so that the anticodon GGUGG could be used to decode a frameshift mutation of CCACC in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011945 1 5nt anti codon range2011945 1 46 50 BBa_K199048_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z