BBa_K199052 1 BBa_K199052 pLux in reverse 2009-07-21T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly This is pLux oriented in an opposite direction to typical BioBrick inserts. false true _295_ 0 5395 9 It's complicated false Had trouble getting this part via PCR. That was probably due to an error in the primers. false Kin Lau BBa_K199052_sequence 1 tttattcgactataacaaaccattttcttgcgtaaacctgtacgatcctacaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z