BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K199008 1 BBa_K199008 CCAUC Suppressor tRNA (10-bp Anticodon and Produces Serine) 2009-06-28T11:00:00Z 2015-05-08T01:11:18Z De novo synthesis from single-stranded oligos. Based on the paper by Anderson et al. 2002. [http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf] This gene encodes for a tRNA suppressor that suppresses a 5-bp codon CCAUC, which would normally cause a frame shift mutation. false false _295_ 0 5112 9 It's complicated false We used the 10-bp anticodon loop that is complementary to the 5-bp codon CCAUC. false Olivia Ho-Shing annotation2006984 1 5' Context range2006984 1 1 11 annotation2006986 1 3' Context range2006986 1 105 144 annotation2006985 1 Anticodon Loop range2006985 1 44 53 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K199009 1 BBa_K199009 RFP with CCAUC Addition 2009-06-28T11:00:00Z 2015-05-08T01:11:18Z The template of the gene comes from BioBrick Part E1010. We designed a forward primer that included ATG, the 5-bp addition CCATC and the first 20 nucleotides on the 5' end of RFP after ATG. This made the edited 5' sequence for our RFP. This RFP reporter gene has a 5-bp addition, CCAUC, after the start codon and before the rest of the gene. This is used in conjunction with the CCAUC tRNA (Parts K199007 and K199008). These CCAUC tRNAs suppress the frameshift caused by this 5-bp addition in the reporter. false false _295_ 0 5112 9 It's complicated false We positioned the start codon, ATG, before the 5-bp codon and continued with the rest of the RFP gene. This way, the RBS wouldn't translate the reporter gene without reading over the 5-base codon first. In order to ligate our edited 5' sequence to the unchanged downstream portion of the RFP gene, we utilized the restriction enzyme NcoI that cuts at a single site 419-bp into BBa_E1010. false Olivia Ho-Shing annotation2013715 1 Double Stop range2013715 1 681 686 annotation2006990 1 NcoI Restriction Site range2006990 1 424 429 annotation2013327 1 25 bp addition range2013327 1 687 711 annotation2006991 1 5-bp CCAUC Addition range2006991 1 4 8 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_K199057 1 BBa_K199057 CCAUC tRNA (10-bp Anticodon) with RFP Reporter 2009-08-04T11:00:00Z 2015-05-08T01:11:19Z From the BioBrick Parts Registry. The tRNA was constructed by oligo assembly, and mutated the RFP reporter, [http://partsregistry.org/wiki/index.php?title=Part:BBa_E1010 E1010], to add the 5-bp insertion by PCR. Suppressor tRNA expressed by the medium-weak promoter, pBad, upstream of RFP with a 5-bp insertion, CCAUC. The tRNA is designed to suppress the insertion, allowing the appropriate translation of functional RFP. false false _295_ 0 5112 9 It's complicated false See the following parts for more information: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K199008 CCAUC tRNA], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K199032 pBad-tRNA] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K199009 RFP with 5-bp addition]. We wanted to create this composite so that the tRNA and reporter would be replicated in the same plasmid, and to be more efficient than a double transformation. false Olivia Ho-Shing component2014865 1 BBa_B0034 component2014856 1 BBa_K199008 component2014857 1 BBa_R0010 component2014852 1 BBa_I13453 component2014870 1 BBa_K199009 annotation2014852 1 BBa_I13453 range2014852 1 1 130 annotation2014865 1 BBa_B0034 range2014865 1 499 510 annotation2014857 1 BBa_R0010 range2014857 1 291 490 annotation2014870 1 BBa_K199009 range2014870 1 517 1227 annotation2014856 1 BBa_K199008 range2014856 1 139 282 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K199009_sequence 1 atgccatcgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_K199008_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggttttgatggagaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199057_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggatccaattcggagagatgccggagcggctgaacggaccggttttgatggagaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgccatcgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z