BBa_K199000 1 BBa_K199000 CCCUC tRNA Suppressor (Produces Serine) 2009-06-24T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCCUC, which would normally cause a frame shift mutation. false false _295_ 0 5114 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCCUC. false Leland Taylor annotation2006690 1 3' Context range2006690 1 104 143 annotation2006689 1 5' Context range2006689 1 1 11 annotation2006688 1 Anti-codon Loop range2006688 1 44 52 BBa_K199061 1 BBa_K199061 CCCUC tRNA with RFP Reporter 2009-08-05T11:00:00Z 2015-05-08T01:11:19Z From the BioBrick Parts Registry. The tRNA was constructed by oligo assembly, and mutated the RFP reporter, [http://partsregistry.org/wiki/index.php?title=Part:BBa_E1010 E1010], to add the 5-bp insertion by PCR. Suppressor tRNA expressed by the medium-weak promoter, pBad, upstream of RFP with a 5-bp insertion, CCCUC. The tRNA is designed to suppress the insertion, allowing the appropriate translation of functional RFP. false false _295_ 0 5112 9 It's complicated false See the following parts for more information: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K199000 CGGUC tRNA], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K199039 pBad-tRNA] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K199011 RFP with 5-bp addition]. We wanted to create this composite so that the tRNA and reporter would be replicated in the same plasmid, and to be more efficient than a double transformation. false Olivia Ho-Shing component2014933 1 BBa_R0010 component2014941 1 BBa_B0034 component2014946 1 BBa_K199011 component2014928 1 BBa_I13453 component2014932 1 BBa_K199000 annotation2014932 1 BBa_K199000 range2014932 1 139 281 annotation2014928 1 BBa_I13453 range2014928 1 1 130 annotation2014946 1 BBa_K199011 range2014946 1 516 1226 annotation2014941 1 BBa_B0034 range2014941 1 498 509 annotation2014933 1 BBa_R0010 range2014933 1 290 489 BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_K199011 1 BBa_K199011 RFP with CCCUC Addition 2009-06-28T11:00:00Z 2015-05-08T01:11:18Z The template of the gene comes from BioBrick part E1010. We designed a forward primer that included the first 20 nucleotides on the 5' end, and a reverse primer that included the last 20 nucleotides on the 3' end of the RFP gene. This RFP reporter gene has a 5-base pair CCACU addition after the start codon and before the rest of the gene. This is used in conjunction with the CCACU tRNA (BioBrick part K199000). This CCACU tRNA suppresses the frameshift caused by this 5-base pair addition in the reporter. false false _295_ 0 5114 9 It's complicated false We positioned the ATG before the 5-base codon and continued with the rest of the RFP gene. This way, the RBS wouldn't read the reporter gene without reading over the 5-base codon first. In order to ligate our 5-base pair addition at the desired position in the reporter gene, we utilized the restriction enzyme NcoI which cut at a single site 424 bp into the gene. false Leland Taylor annotation2013716 1 Double Stop range2013716 1 681 686 annotation2013328 1 25 bp addition range2013328 1 687 711 annotation2006994 1 CCCUC 5 Base Addition range2006994 1 4 8 annotation2006995 1 Nco1 restriction site range2006995 1 424 429 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K199000_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_B0034_sequence 1 aaagaggagaaa BBa_K199061_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgccctcgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K199011_sequence 1 atgccctcgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z