BBa_K199066 1 BBa_K199066 pLac-RBS-CCACU-RFP 2009-08-05T11:00:00Z 2015-05-08T01:11:19Z From the BioBrick Parts Registry. Intermediate part to be used with suppressor tRNA CCACU. false false _295_ 0 5112 9 It's complicated false pLac can be induced with IPTG for greater probability of tRNA suppression, and expression. false Olivia Ho-Shing component2015104 1 BBa_R0010 component2015117 1 BBa_K199005 component2015112 1 BBa_B0034 annotation2015112 1 BBa_B0034 range2015112 1 209 220 annotation2015117 1 BBa_K199005 range2015117 1 227 937 annotation2015104 1 BBa_R0010 range2015104 1 1 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K199005 1 BBa_K199005 RFP with CCACU Addition 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z The template of the gene comes from BioBrick part E1010. We designed a forward primer that included the first 20 nucleotides on the 5' end, and a reverse primer that included the last 20 nucleotides on the 3' end of the RFP gene. This RFP reporter gene has a 5-base pair CCACU addition after the start codon and before the rest of the gene. This is used in conjunction with the CCACU tRNA (BioBrick part [http://partsregistry.org/Part:BBa_K199002 K199002]). This CCACU tRNA suppresses the frameshift caused by this 5-base pair addition in the reporter. false false _295_ 0 5120 9 It's complicated false We positioned the ATG before the 5-base codon and continued with the rest of the RFP gene. This way, the RBS wouldn't read the reporter gene without reading over the 5-base codon first. In order to ligate our 5-base pair addition at the desired position in the reporter gene, we utilized the restriction enzyme NcoI which cut at a single site 424 bp into the gene. false Shamita Punjabi annotation2006731 1 5 base pair addition range2006731 1 4 8 annotation2013714 1 Double Stop range2013714 1 681 686 annotation2006732 1 Nco1 restriction site range2006732 1 424 429 annotation2013325 1 25 bp addition range2013325 1 687 711 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961224 1 -35 range1961224 1 137 142 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 BBa_K199005_sequence 1 atgccactgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K199066_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgccactgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z