BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K199016 1 BBa_K199016 CUAGC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' CUGCUAGAA 3'so that the anticodon GCUAG could be used to decode a frameshift mutation of CUAGC in a mRNA. false false _295_ 0 5118 9 It's complicated false none false Clifton Davis annotation2007936 1 5 nt anitcodon range2007936 1 46 50 BBa_K199070 1 BBa_K199070 I13453:K199016 Pbad promotor with the suppressor tRNA of CUAGC 2009-07-12T11:00:00Z 2015-05-08T01:11:19Z false true _9_ 0 5115 9 It's complicated false false William Vernon component2011258 1 BBa_K199016 component2011256 1 BBa_I13453 annotation2011256 1 BBa_I13453 range2011256 1 1 130 annotation2011258 1 BBa_K199016 range2011258 1 139 281 BBa_K199070_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K199016_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgctagaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z