BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K199014 1 BBa_K199014 AGGAC tRNA Suppressor (Produces Serine) 2009-07-01T11:00:00Z 2015-05-08T01:11:18Z Synthesized from oligonucleotides and sequence verified. A serine tRNA was modified to have the anticodon loop 5' CUGUCCUAA 3'so that the anticodon GUCCA could be used to decode a frameshift mutation of AGGAC in a mRNA. false false _295_ 0 5115 9 It's complicated false None. false William Vernon annotation2007934 1 5 nt anticodon range2007934 1 46 50 BBa_K199071 1 BBa_K199071 I13453:K199014: Pbad promomtor with the suppressor tRNA of the codon AGGAC 2009-07-12T11:00:00Z 2015-05-08T01:11:19Z false true _9_ 0 5115 9 It's complicated false false William Vernon component2011253 1 BBa_I13453 component2011255 1 BBa_K199014 annotation2011253 1 BBa_I13453 range2011253 1 1 130 annotation2011255 1 BBa_K199014 range2011255 1 139 281 BBa_K199071_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgtcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K199014_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgtcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z