BBa_K199074 1 BBa_K199074 RBS RFP with AGGAC Addition 2009-09-19T11:00:00Z 2015-05-08T01:11:19Z The template of the gene comes from Part BBa_E1010. We designed a forward primer that included RBS,ATG, the 5-bp addition AGGAC and the first 20 nucleotides on the 5' end of RFP after ATG. This made the edited 5' sequence for our RFP. This RBS RFP reporter gene is a modification of BBa_E1010 with BBa_B0034; it has a 5-bp addition, AGGAC, after the start codon and before the rest of the gene. This is used in conjunction with the AGGAC tRNA(Part K199014). These AGGAC tRNAs suppress the frameshift caused by this 5-bp addition in the reporter. There is also a 25 bp addition after the double stop of the gene and before the Bio Brick Suffix. This addition is presumed to not effect the translation of the protein. Sequence and Features false false _295_ 0 5118 9 It's complicated false None false Clifton Davis annotation2023118 1 NcoI Site range2023118 1 442 442 annotation2023120 1 25-bp addition range2023120 1 705 729 annotation2023119 1 5-bp AGGAC addition range2023119 1 22 26 BBa_K199074_sequence 1 aaagaggagaaatactagatgaggacgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z