BBa_K199078 1 BBa_K199078 RBS RFP with CCAAU Addition 2009-09-19T11:00:00Z 2015-05-08T01:11:19Z The template of the gene comes from Part BBa_E1010. We designed a forward primer that included RBS,ATG, the 5-bp addition CCAAU and the first 20 nucleotides on the 5' end of RFP after ATG. This made the edited 5' sequence for our RFP. This RBS RFP reporter gene is a modification of BBa_E1010 with BBa_B0034; it has a 5-bp addition, CCAAU, after the start codon and before the rest of the gene. This is used in conjunction with the CCAAU tRNA(Part K199047). These CCAAU tRNAs suppress the frameshift caused by this 5-bp addition in the reporter. There is also a 25 bp addition after the double stop of the gene and before the Bio Brick Suffix. This addition is presumed to not effect the translation of the protein. false false _295_ 0 5118 9 It's complicated false None false Clifton Davis annotation2023130 1 NcoI Restriction Site range2023130 1 442 442 annotation2023131 1 5-bp CCAAU Addition range2023131 1 22 26 annotation2023132 1 25-bp Addition range2023132 1 705 729 BBa_K199078_sequence 1 aaagaggagaaatactagatgccaatgcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z