BBa_K199081 1 BBa_K199081 pBad-CCACC Suppressor tRNA 2009-09-24T11:00:00Z 2015-05-08T01:11:19Z assembled oligos and registry Causes low expression of a suppressor tRNA that suppresses a 5-bp codon CCACC, Part K199048 . false false _295_ 0 5115 9 Not in stock false no false William Vernon component2027911 1 BBa_I13453 component2027913 1 BBa_K199048 annotation2027913 1 BBa_K199048 range2027913 1 139 281 annotation2027911 1 BBa_I13453 range2027911 1 1 130 BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K199048 1 BBa_K199048 CCACC tRNA Suppressor (Produces Serine) 2009-07-19T11:00:00Z 2015-05-08T01:11:19Z Oligo assembly A serine tRNA was modified to have the anticodon loop 5' UUGGUGGAA 3'so that the anticodon GGUGG could be used to decode a frameshift mutation of CCACC in a mRNA. false false _295_ 0 5115 9 It's complicated false no false William Vernon annotation2011945 1 5nt anti codon range2011945 1 46 50 BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K199081_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199048_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttggtggaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z