BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_K199000 1 BBa_K199000 CCCUC tRNA Suppressor (Produces Serine) 2009-06-24T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCCUC, which would normally cause a frame shift mutation. false false _295_ 0 5114 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCCUC. false Leland Taylor annotation2006688 1 Anti-codon Loop range2006688 1 44 52 annotation2006689 1 5' Context range2006689 1 1 11 annotation2006690 1 3' Context range2006690 1 104 143 BBa_K199090 1 BBa_K199090 R0040:K199000 2009-10-03T11:00:00Z 2015-05-08T01:11:19Z ? Construction intermediate false false _295_ 0 5109 9 It's complicated false ? false Romina Clemente component2028055 1 BBa_R0040 component2028063 1 BBa_K199000 annotation2028063 1 BBa_K199000 range2028063 1 63 205 annotation2028055 1 BBa_R0040 range2028055 1 1 54 BBa_K199090_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199000_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z